Dynamique de transmission des entérobactéries productrices de β-lactamase à spectre élargi dans l’hôpital de soins tertiaires et le milieu familial

Contexte Les études sur les taux de transmission des β-lactamases à spectre étendu d’entérobactéries productrices de BLSE dans les hôpitaux et les ménages sont rares. Méthodologie Quatre-vingt-deux patients avec un nouveau portage d’Escherichia coli productrices de BLSE ESBL-Ec; n = 72 ou Klebsiella pneumoniae productrice de BLSE, BLSE-Kp; n = 10 et n = 112 et n = 96 contacts ont été étudiés prospectivement de mai 2008 à septembre 2010 Les isolats ont été séquencés phénotypiquement et moléculairement caractérisés de gènes bla, réaction en chaîne polymérase palindromique extragène répétitive, électrophorèse sur gel à champ pulsé et multilocus typage de séquence La transmission a été définie comme le transport d’un producteur de BLSE lié au clonage avec des gènes blaESBL identiques chez le patient index et ses contacts. Les résultats CTX-M-15 étaient les BLSE les plus prévalents en ESBL-Ec 58% et ESBL-Kp 70% en les patients de l’indice Vingt-huit isolats de BLSE-Ec étaient du clone hyperepidémique ST131 À l’hôpital, les taux de transmission étaient de 45% ESBL-Ec et 83% BLSE-Kp et les incidences de transmissions étaient de 56 Ec et 139 Kp pour 1000 jours d’exposition. respectivement L’incidence de la transmission hospitalière BLSE-Kp était significativement plus élevée que celle de BLSE-EC P & lt; 0001, malgré la mise en place de mesures de contrôle de l’infection chez 75% des patients index BLSE-Kp mais seulement 22% des patients index ESBL-Ec. La détection des BLSE non liés à un patient index était aussi fréquente ESBL-Ec, 57%; ESBL-Kp, 167% comme événements de transmission nosocomiale Dans les ménages, les taux de transmission étaient de 23% pour ESBL-Ec et de 25% pour BLSE-KpConclusions Les ménages dépassent la transmission nosocomiale des producteurs de BLSE L’effet des mesures de contrôle des infections hospitalières peut différer selon les espèces et clones des producteurs de BLSE

Depuis la fin des années 1980, les entérobactéries productrices de β-lactamases à spectre étendu, principalement Klebsiella pneumoniae, ont été reconnues comme une cause majeure d’infections nosocomiales et d’éclosions [1] Cependant, à la fin des années 1990, les gènes blaESBL contexte communautaire dans le contexte des infections des voies urinaires infections urinaires causées par Escherichia coli [2, 3] Actuellement, le CTX-M-15 est reconnu comme le blaESBL le plus largement distribué parmi les entérobactériacées [4, 5], et la propagation mondiale du E coli hyper-épidémique de type séquence ST 131 représente l’un des défis majeurs pour les systèmes de santé [6, 7] Une stratégie importante pour contrôler la propagation de ces agents pathogènes multirésistants est l’identification des patients présentant des risques d’acquisition [2, 8] De plus, des mesures de surveillance active et d’isolement sont recommandées. Http: //www.premierinccom/security/ topics / guidelines / cdc_guidelinesjsp Cependant, les directives proposées renvoient à Seules les situations de rupture et les données sur l’efficacité des mesures de contrôle des infections dans les hôpitaux endémiques ou même dans la communauté ne sont pas disponibles [9, 10] La transmission communautaire des BLSE indique que la transmission interhumaine peut survenir en dehors de l’hôpital cavité. [11, 12] Le transport prolongé de producteurs de BLSE dans le tractus gastro-intestinal des patients après la sortie de l’hôpital peut améliorer cette transmission [13] Ainsi, une meilleure compréhension de la dynamique de transmission des producteurs de BLSE Dans la présente étude, nous avons évalué de façon prospective les taux de transmission de E. coli productrices de BLSE, de E. coli ESBL-Ec et de K pneumoniae productrice de BLSE, de patients atteints d’un colocataires hospitaliers et aux ménages Nos données indiquent que le taux de transmission est significativement plus élevé au sein des ménages t han dans notre scénario d’hospitalisation hors épidémie

Méthodes

Études et recrutement de patients

Une étude longitudinale prospective a été réalisée entre le 1er mai 2008 et le 30 septembre 2010. Les patients de l’Index et leurs contacts hospitaliers ont été recrutés du 1er mai 2008 au 30 septembre 2009 à l’hôpital universitaire de Berne (Suisse), un hôpital tertiaire de 1033 lits. une unité mixte de soins intensifs de 30 lits et plus de 35 000 admissions produisant 280 000 jours-patients par an. Les patients inclus dans l’étude incluaient l’âge pédiatrique, 10 ans et les patients adultes hospitalisés ou traités en ambulatoire au centre d’étude présentant un portage ou infection nouvellement détecté avec ESBL-Ec ou ESBL-Kp L’étude a été menée conformément aux exigences locales du comité d’éthique

Définitions

Les patients ont été catégorisés comme patients hospitalisés s’ils ont dû être hospitalisés pendant> 24 heures. Un patient index a été défini comme patient hospitalisé ou ambulatoire avec une infection nouvellement reconnue ou une colonisation avec des isolats BLSE-Ec ou BLSE-Kp Les patients hospitalisés ont été définis comme colocataires Les personnes-ressources du ménage étaient définies comme des personnes qui partageaient régulièrement le même foyer avec le patient-index. Transmission assurée lorsque le patient-index et les contacts partagé un clonale-voir ci-dessous ESBL-Ec ou ESBL-Kp isoler avec des gènes blaESBL identiques

Collecte de données

Pour les patients hospitalisés et ambulatoires inclus dans l’étude, la présence des facteurs de risque suivants pour le transport actif BLSE au cours des 3 mois précédents ont été considérés: hospitalisation antérieure, séjour en USI, interventions chirurgicales, utilisation de dispositifs à demeure, cathéters intravasculaires et urinaires, endotrachéale et tubes naso-gastriques, trachéotomie et drainages, péritonéale ou hémodialyse, incontinence urinaire ou fécale, IVU récidivante, auto-cathétérisme intermittent ou autres conditions urologiques chroniques, présence de lésions cutanées, élevage domestique ou d’élevage, traitement antibiotique, traitement immunosuppresseur, c.-à-d. , ≥20 mg / j de prednisone, radiothérapie, chimiothérapie ou immunomodulateurs La présence et la gravité de la comorbidité ont été évaluées au moment du recrutement en calculant l’indice de comorbidité de Charlson [14] Paramètre du patient Exemple: établissement de soins de longue durée, hôpital de soins actifs ménage privé a été enregistré au recrutement voir ci-dessous

Politique de contrôle des infections

Selon les directives locales de contrôle des infections, les patients porteurs du BLSE ont été mis en contact s’ils présentaient l’un des facteurs de risque susmentionnés. Le protocole d’isolement impliquait l’utilisation de gants par le personnel médical lors de tout contact physique et de toute procédure médicale. Pour les patients à l’USI, des mesures d’isolement ont été mises en place dans les chambres à 4 lits. La conformité à l’hygiène des mains à l’échelle de l’hôpital est surveillée sur une base annuelle. Depuis 2005, selon la méthodologie SwissNOSO Globalement, la conformité était de 62% en 2008, de 63% en 2009 et de 68% en 2010 http: // wwwswissnosoch

Programme de dépistage et de suivi

La période de suivi pour les patients hospitalisés et ambulatoires et leurs contacts était de 12 mois sauf décès ou séjour à l’étranger. Pour les patients hospitalisés, des échantillons de dépistage ont été obtenus au moment de la première détection de l’organisme producteur de BLSE et hebdomadairement jusqu’à la sortie de l’hôpital. Les échantillons de dépistage comprenaient un échantillon de selles et, pour les patients index seulement, des échantillons d’urine dans le cas d’un cathéter de Foley, des échantillons respiratoires en cas d’intubation ou de trachéotomie et, le cas échéant, échantillons de liquide de drainage et prélèvements de lésions cutanées Le dépistage a été arrêté si le patient index et ses contacts familiaux ont été négatifs dans 2 dépistages consécutifs. Pour les patients ambulatoires, un échantillon fécal a été prélevé au moment de la première détection du producteur BLSE et trimonthly Par la suite, des échantillons de dépistage ont été obtenus en cas d’hospitalisation au centre d’étude au cours de période de réveil Les patients hospitalisés ont été examinés toutes les semaines jusqu’à une semaine après la séparation physique du patient indexé et à la sortie de l’hôpital si le dernier dépistage avait été effectué & gt; 7 jours avant la sortie

Détection et analyse phénotypique des isolats

Les échantillons de selles ont été analysés avec différents milieux de culture sélectifs conçus pour détecter les isolats résistants aux céphalosporines: agar BLSE ChromID, gélose BLSE, bi-plaque avec 2 milieux sélectifs Gélose MacConkey plus ceftazidime et Gélose Drigalski plus céfotaxime à une concentration de 2 et 15 mg / L, respectivement, et CHROMagar BLSE Les colonies en croissance ont été identifiées par des méthodes biochimiques standard et le système Vitek 2. La confirmation phénotypique de la production de BLSE a été obtenue en utilisant le test de synergie double disque avec ceftazidime, cefpodoxime et aztréonam en combinaison avec amoxicilline-clavulanate [15] La corésistance à d’autres antibiotiques a été évaluée par diffusion sur disque et interprétée selon les critères du Clinical Laboratory Standards Institute [16] Les isolats multirésistants étaient résistants à au moins 1 représentatif de ≥3 classes antimicrobiennes décrites ailleurs [6]

Caractérisation moléculaire des isolats producteurs de BLSE

Réaction en chaîne par polymérase PCR pour les gènes blaTEM et blaSHV comme décrit ailleurs [17, 18] Pour les gènes blaCTX-M, des amorces universelles ont été utilisées comme écran initial révélant les groupes CTX-M distincts 1, 2 et 4 [19] , des amorces spécifiques du groupe blaCTX-M ont été utilisées pour l’amplification et le séquençage CTX-Ms du groupe 1 CTX-M_F_Grp1, TGGTTAAAAAATCACTGCGYCA; CTX-M_R_Grp1, GTYGGTGACGATTTTAGCC; CTX-M_R2_Grp1, ACAGAYTCGGTTCGCTTTCA, groupe 2 CTX-M_F_Grp2, AATGTTAACGGTGATGGCGA; CTX-M_R_Grp2, GATTTTCGCCGCCGCA et le groupe 4 CTX-M_F_Grp4, AGAGARTGCAACGGATGATGT; CTX-M_R_Grp4, CCCYTYGGCGATGATTCTC; Le séquençage CTX-M_F2_Grp4, CAGACGTTGCGTCAGCTTACDNA a été réalisé selon les instructions du fabricant à l’aide du séquenceur ABI 3130 Les séquences ont été analysées à l’aide de MEGA 4 [20], traduites en séquences protéiques, et comparées à celles précédemment décrites: http: // wwwlaheyorg / Etudes / types ont été identifiés à savoir, TEM-191 et TEM-192; numéros d’accès JF949915 et JF949916, respectivement

Analyse de la relation clonale

Les groupes phylogénétiques, c’est-à-dire A, B1, B2 et D de BLSE-Ec ont été déterminés comme indiqué ailleurs [21]. Le typage multilocus pour des isolats choisis de BLSE-CE et de BLSE-Kp a été effectué selon les schémas d’Achtman et de Pasteur. , 23] En outre, tous les ESBL-Ec du groupe phylogénétique B2 ont été testés pour l’allèle pabB pour détecter ceux de ST131 selon le schéma Achtman [24] La parenté des isolats ESBL-Ec et ESBL-Kp a également été analysée par champ pulsé électrophorèse sur gel PFGE utilisant l’enzyme de restriction XbaI et la PCR palindromique répétitive PCR répétée [25, 26] Les empreintes digitales rep-PCR et PFGE résultantes ont été analysées en utilisant le bioanalyseur et le logiciel GEL-COMPAR II Le coefficient cosinus et la méthode des groupes non pondérés avec arithmétique a été utilisé pour l’analyse en grappes Les isolats ESBL-Ec ont été définis comme apparentés au clonage lorsqu’ils partageaient le même groupe phylogénétique,> 85% de parenté génétique par rep-PCR et des profils de bande PFGE similaires tels que définis par les critères de Tenover c.-à-d. différant de ≤3 bandes [26] Les isolats de BLSE-Kp liés au clonage ont été définis comme ceux de BLSE-CE mais le seuil de coupure de la PCR-rep était> 90%

Analyses statistiques

À l’aide de STATA version 10, les variables continues et catégoriques ont été testées par le test t de Student et le test exact de Fisher à deux queues, respectivement les courbes de Kaplan-Meier ont été dérivées par le logiciel Prism et les différences calculées à l’aide du test log-rank

RÉSULTATS ET DISCUSSION

Caractéristiques moléculaires et profils de résistance aux antibiotiques des isolats producteurs de BLSE des patients de l’indice

Un total de 82 patients indexés 48 patients hospitalisés et 34 patients ambulatoires avec une infection ou une colonisation due à ESBL-Ec n = 72 ou ESBL-Kp n = 10 ont été inclus dans l’étude Tableau 1 Nouveaux cas index ont été détectés avec une fréquence médiane de 48 , 1 à 9 patients par mois mais pas de flambée épidémique Figure 1 L’incidence moyenne des patients hospitalisés indexés était de 012 cas par 1000 patients-jours 48 patients hospitalisés pour un total de 400 000 jours-patients selon une étude allemande récente dans laquelle une incidence de 012 cas par 1000 jours-patients a été observée [27]

Tableau 1 Caractéristiques moléculaires et profils de résistance aux antibiotiques des Escherichia coli productrices de β-lactamase à spectre étendu et des isolats de Klebsiella pneumoniae Espèces et groupe phylogénétique, non% Paramètre Ec A Ec B1 Ec B2 pabB- Ec B2 pabBa Ec D Ec tous Kp tous Total Total 21 7 3 20 21 72 10 82 Gènes BLSE blaCTX-M-1 4 19 1 14 0 0 0 0 1 5 6 8 0 0 6 7 blaCTX-M-14 1 5 0 0 0 0 3 15 3 14 7 10 1 10 8 10 blaCTX-M-15 12 57 2 29 1 33 14 70 13 62 42 58 6 60 48 59 blaCTX-M-15 et blaSHV-5 0 0 0 0 0 0 0 0 0 0 0 0 1 10 1 1 blaCTX-M -27 0 0 1 14 0 0 1 5 1 5 3 4 0 0 3 3 blaSHV-2 / -2A / -5 / -12 1 5 0 0 1 33 1 5 0 0 3 4 2 20 5 6 Autre 1 5 3 43 1 33 1 5 2 10 8 11 0 0 8 10 Inconnue blaESBL 2 10 0 0 0 0 0 0 1 5 3 4 0 0 3 4 Résistance phénotypeb Gentamicine 8 38 2 29 2 67 11 55 13 62 36 50 10 100 46 56c Ciprofloxacine 15 71 4 57 0 0 17 85 12 57 48 67 8 80 56 68d Triméthoprime-sulfaméthoxazole 17 81 6 86 2 67 12 60 17 81 5475 9 90 63 77 Pipéracilline-tazobactame 10 48 2 29 0 0 5 25 1 5 18 25 7 70 25 30 MDR isolatese 10 48 3 43 0 0 9 45 7 33 29 40 9 90 38 46 Groupe d’espèces et phylogénie, No% Paramètre Ec A Ec B1 Ec B2 pabB- Ec B2 pabBa Ec D Ec tous Kp tous Total Total 21 7 3 20 21 72 10 82 Gènes ESBL blaCTX-M-1 4 19 1 14 0 0 0 0 1 5 6 8 0 0 6 7 blaCTX-M-14 1 5 0 0 0 0 3 15 3 14 7 10 1 10 8 10 blaCTX-M-15 12 57 2 29 1 33 14 70 13 62 42 58 6 60 48 59 blaCTX-M-15 et blaSHV-5 0 0 0 0 0 0 0 0 0 0 0 0 1 10 1 1 blaCTX-M-27 0 0 1 14 0 0 1 5 1 5 3 4 0 0 3 3 blaSHV-2 / -2A / -5 / -12 1 5 0 0 1 33 1 5 0 0 3 4 2 20 5 6 Autre 1 5 3 43 1 33 1 5 2 10 8 11 0 0 8 10 Inconnu blaESBL 2 10 0 0 0 0 0 0 1 5 3 4 0 0 3 4 Résistance phénotypeb Gentamicin 8 38 2 29 2 67 11 55 13 62 36 50 10 100 46 56c Ciprofloxacine 15 71 4 57 0 0 17 85 12 57 48 67 8 80 56 68d Triméthoprime-sulfaméthoxazole 17 81 6 86 2 67 12 60 17 81 5475 9 90 63 77 Pipéracilline -tazobactam 10 48 2 29 0 0 5 25 1 5 18 25 7 70 25 30 MDR isolatese 10 48 3 43 0 0 9 45 7 33 29 40 9 90 38 46 Abréviations: Ec, Escherichia coli; BLSE, ß-lactamase à spectre étendu; Kp, Klebsiella pneumoniae; MDR, multirésistante Le groupe phylogénétique B2 avec le gène pabB sont indicatifs pour le type de séquence 131 selon le schéma de typage de séquence multilocus d’Achtmanb La sensibilité intermédiaire a été groupée comme résistancec Trente-six des 46 isolats portés blaCTX-M-15 P & lt; 001d Quarante-et-un des 56 isolats portaient le blaCTX-M-15 P & lt; 001e Les isolats MDR étaient résistants à au moins 1 représentatif de ≥ 3 classes d’antimicrobiens comme décrit ailleurs [6] View Large

Figure 1Voir grand DiapositiveNombre de nouveaux cas d’isolats de Klebsiella pneumoniae ou d’Escherichia coli producteurs de β-lactamase à large spectre détectés de mai 2008 à septembre 2009 Les données sur les E. coli sont stratifiées selon les groupes phylogénétiques A, B1, B2 et DE coli du groupe B2 qui sont positifs pour le gène pabB sont indicatifs pour le type de séquence 131 selon le schéma de typage de séquence multilocus Achtman [24] Abréviations: Ec, Escherichia coli; Kp, Klebsiella pneumoniaeFigure 1View largeDownload slideNombre de nouveaux cas d’isolats de Klebsiella pneumoniae ou d’Escherichia coli producteurs de β-lactamases à spectre étendu détectés de mai 2008 à septembre 2009 Les données sur E coli sont stratifiées en fonction des groupes phylogénétiques A, B1, B2 et Les isolats DE coli du groupe B2 qui sont positifs pour le gène pabB sont indicatifs pour le type de séquence 131 selon le schéma de typage de séquence multilocus Achtman [24] Abréviations: Ec, Escherichia coli; Kp, Klebsiella pneumoniae Dans l’ensemble, les producteurs de CTX-M-15 étaient les isolats ESBL-Ec n = 42 et ESBL-Kp n = 7 les plus prévalents. Tableau 1 ESBL-Ec regroupés principalement dans les groupes phylogénétiques A, B2 et D Vingt-huit isolats étaient de ST131 selon le schéma d’Achtman Tableau 1 La présence de blaCTX-M-15 était associée à une résistance à la ciprofloxacine et à la gentamicine P & lt; 001 et P & lt; 001, respectivement Comme précédemment observé, la résistance à la ciprofloxacine était très prévalente parmi les BLSE-CE de ST131 [6]

Caractéristiques des patients de l’indice et échantillonnage des isolats producteurs de BLSE

Comme le montre le tableau 2, 13% des patients indexés étaient des enfants Une étude suisse antérieure avait déjà indiqué que cette population pouvait constituer un réservoir important de producteurs de BLSE [28] Selon la littérature, les voies urinaires étaient la source la plus fréquente de BLSE. producteurs [2] Les patients de l’index avaient une maladie sous-jacente plus sévère et étaient plus fréquemment référés en milieu hospitalier par rapport aux patients ambulatoires de l’indice Presque tous les patients indexés avaient reçu un traitement antibiotique au cours des 3 mois précédant la détection des producteurs de BLSE.

Tableau 2Caractéristiques des patients de l’indice 82 porteurs d’isolats produisant la β-lactamase à spectre étendu Valeur pour les patients de l’indice n = 82 Paramètre Patients externes Patients hospitalisés Total 34 48 Âge en années, moyenne ± écart-type 398 ± 233 582 ± 215 & lt; 10 7 4 10- 50 14 5 & 50 50 13 39 Féminin, Non% 29 85 23 48 Score de Charlson, moyenne ± SD 10 ± 23 30 ± 27a Score de Charlson, ajusté en fonction de l’âge, moyenne ± DS 17 ± 26 47 ± 33a Référé de, Non% 100 25 52 Autre hôpital 0 0 11 23 Établissement de soins de longue durée 0 0 4 8 Autre 0 0 4 8 Inconnu 0 0 4 8 Type d’échantillon avec le producteur de BLSE détecté, Non% Urine 32 94 27 56 Culture sanguine 0 0 5 10 Trachéale Aspirations 0 0 3 6 Blessures 0 0 4 8 Matières fécales 0 0 2 4 Autres 2 6 7 15 Exposition aux antibiotiques pendant les 3 mois précédant la consultation de l’hôpital, Non% Oui 30 88 39 81 Non 2 6 0 0 Inconnu 2 6 9 19 Traitement antibiotique nt à la date d’échantillonnage, Non% Oui 14 41 32 67 Non 15 44 5 10 Inconnu 5 15 11 23 Espèces bactériennes avec ESBL, No% Escherichia coli 32 94 40 83 Klebsiella pneumoniae 2 6 8 17 Dépistage initial des échantillons de selles, No% BLSE producteur de l’espèce identiqueb 22 65 34 71 BLSE producteur d’espèces différentesb 0 0 5 10 Aucun producteur de BLSE détecté 10 29 7 15 Aucun dépistage initial effectué 2 6 2 4 Valeur pour l’index Patients n = 82 Paramètre Patients externes Patients hospitalisés Total 34 48 Âge en années , moyenne ± SD 398 ± 233 582 ± 215 & lt; 10 7 4 10-50 14 5 & 50 50 39 39 Femme, Non% 29 85 23 48 Score de Charlson, moyenne ± SD 10 ± 23 30 ± 27a Score de Charlson, ajusté en fonction de l’âge , moyenne ± SD 17 ± 26 47 ± 33a Référé de, No% Ménage 34 100 25 52 Autre hôpital 0 0 11 23 Établissement de soins de longue durée 0 0 4 8 Autre 0 0 4 8 Inconnu 0 0 4 8 Type d’échantillon avec ES BL producteur détecté, Non% Urine 32 94 27 56 Hémoculture 0 0 5 10 Aspirations trachéales 0 0 3 6 Blessure 0 0 4 8 Matières fécales 0 0 2 4 Autre 2 6 7 15 Exposition aux antibiotiques pendant les 3 mois précédant la référence à l’hôpital, Non % Oui 30 88 39 81 Non 2 6 0 0 Inconnu 2 6 9 19 Traitement antibiotique à la date d’échantillonnage, Non% Oui 14 41 32 67 Non 15 44 5 10 Inconnu 5 15 11 23 Espèces bactériennes avec ESBL, Non% Escherichia coli 32 94 40 83 Klebsiella pneumoniae 2 6 8 17 Criblage initial des échantillons de selles, Non% BLSE producteur de l’espèce identiqueb 22 65 34 71 BLSE producteur d’espèces différentesb 0 0 5 10 Aucun producteur de BLSE détecté 10 29 7 15 Aucun criblage initial effectué 2 6 2 4 Abréviations: BLSE, β-lactamase à spectre étendu; SD, écart-typea Données non disponibles pour 3 patients-indexb Comparés avec le premier isolat producteur de BLSEVoir GrandLe temps moyen ± écart-type entre la collecte de l’échantillon initial et le premier dépistage était de 184 jours ± 297 dans l’échantillon clinique a été détecté dans le dépistage initial chez 65% des patients externes et 71% des patients hospitalisés, ce qui est comparable à une étude antérieure [11] Les patients hospitalisés ont séjourné à l’hôpital pendant une moyenne ± écart-type de 346 jours ± 371 Le producteur de BLSE a été détecté dans les 48 heures après l’entrée à l’hôpital dans 20 42% des données sur les patients hospitalisés de l’indice non indiqués

Dynamique de transmission à l’hôpital

Au total, 88 patients hospitalisés ont été exposés pendant 715 jours à l’indice 40 chez des patients atteints de BLSE-CE pour un écart-type moyen de 81 jours ± 58. Le temps de suivi moyen ± écart-type des contacts hospitaliers était de 276 jours. -Ec a été trouvé chez 9 des 88 patients avec un contact de 102%. Figure 1 Selon la définition de l’étude, la transmission du patient index a été supposée pour 4 contacts, à savoir les patients 36, 16, 110 et 70; Figure 2 Le taux de transmission global pour ESBL-Ec était donc de 45% 4 des 88 contacts exposés, correspondant à une incidence de transmission de 56 cas pour 1000 jours d’exposition Les taux de transmission observés étaient compatibles avec un taux de transmission de 28% et 42 cas pour 1000 jours d’exposition [29]

Figure 2View largeDownload slideCaractéristiques des transmissions hospitalières des patients indexés aux contacts hospitaliers des séquences de Klebsiella pneumoniae et d’Escherichia coli ST à spectre étendu de β-lactamase productrices de BLSE sont montrées selon le schéma de MLST de Pasteur K pneumoniae et Achtman E coli. Les isolats coli du groupe B2 qui sont positifs pour le gène pabB sont indicatifs de ST131 selon le schéma Achtman MLST Le criblage initial des échantillons de fèces a révélé des résultats identiques pour 8 patients Pour le restant, 2 E. coli productrices de BLSE au lieu de K pneumoniae productrices de BLSE ont été détectés, c.-à-d., les patients de l’index 186 et 115, alors que 1 résultats négatifs de l’échantillon de selles a été obtenu, à savoir, patient 110 Abréviations: Ec, Escherichia coli; SC, contact hospitalier; Unité de soins intensifs, unité de soins intensifs; Kp, Klebsiella pneumoniae; PFGE, électrophorèse sur gel à champ pulsé; rep-PCR, réaction en chaîne de polymérase palindromique extragénique; Les types de séquences ST de Klebsiella pneumoniae et d’Escherichia coli productrices de BLSE à spectre étendu sont présentés selon les schémas MLST de Pasteur K pneumoniae et de Achtman E coli. De plus, les isolats E coli du groupe B2 positifs pour le gène pabB sont indicatifs de ST131 selon Achtman. MLST Le criblage initial des échantillons de fèces a révélé des résultats identiques pour 8 patients Pour les 2 autres E. coli productrices de BLSE au lieu des BLSE initiaux. la production de K pneumoniae a été détectée, c.-à-d. les patients indexés 186 et 115, tandis que 1 résultat négatif d’échantillon de selles a été obtenu, c.-à-d. patient 110 Abréviations: Ec, Escherichia coli; SC, contact hospitalier; Unité de soins intensifs, unité de soins intensifs; Kp, Klebsiella pneumoniae; PFGE, électrophorèse sur gel à champ pulsé; rep-PCR, réaction en chaîne de polymérase palindromique extragénique; ST, type de séquence Un total de 24 patients hospitalisés ont été exposés à l’indice 8 chez des patients atteints de BLSE-KP pendant 144 jours pour une moyenne ± ET de 60 jours ± 43 ESBL-Kp a été retrouvé dans 7 des 24 291% des contacts hospitaliers. mais la transmission était plausible pour seulement 2 contacts 83%; incidence, 138 cas pour 1000 jours d’exposition; Figure 2 Par conséquent, le taux de transmission était plus élevé pour BLSE-Kp 83% que pour BLSE-CE 45%, bien que la différence n’atteigne pas la signification statistique Cependant, les incidences de BLSE-Ec 56 cas pour 1000 jours d’exposition et BLSE-Kp 138 cas par 1000 jours d’exposition la transmission a entraîné une incidence significativement plus élevée de la transmission BLSE-Kp P & lt; 0001 Cela suggère que BLSE-Kp a un potentiel de transmission plus élevé que BLSE-CE, en fonction de la fréquence des éclosions nosocomiales ESBL-Kp signalées dans la littérature. Données supplémentaires Notamment, les ST ESBL-Kp impliquées dans les événements de transmission étaient ST11 et ST323 , qui ont été identifiés comme des clones fréquemment détectés portant également blaKPC [30]

Effet des précautions d’isolement à l’hôpital

La plupart des patients indexés avec 75% de BLSE ne sont pas sous précautions d’isolement pendant l’exposition des contacts 537 sur 715 jours d’exposition En revanche, seulement 22% des patients indexés BLSE-Kp 32 des 144 jours d’exposition n’étaient pas isolés P & lt; 001 Par conséquent, on pouvait s’attendre à un taux de transmission plus élevé pour ESBL-Ec que BLSE-Kp, alors que le contraire a été observé, en accord avec un potentiel de transmission plus élevé de BLSE-Kp comme discuté plus haut. Dans cette étude, les patients indexés n’étaient isolés que s’ils avaient des facteurs de risque de transmission. Par conséquent, les patients indexés avec BLSE-Kp étaient probablement plus susceptibles de servir de source de transmission que les patients indexés avec ESBL-Ec. les patients étaient plus souvent aux soins intensifs pendant au moins 1 jour n = 4; 50% que les patients de l’index colonisés par BLSE-Ec n = 11; 275% et pourrait donc avoir subi plus de procédures cliniques menant à la transmission

La dynamique de transmission dans le milieu domestique

ESBL-Ec a été trouvé dans 31 352% des 88 contacts familiaux, mais sur la base de l’analyse moléculaire, la transmission était plausible pour seulement 20 227% des contacts 20 transmissions dans 17 grappes de ménages Ec; Figure 3 Une étude espagnole a révélé un taux de transmission plus faible parmi les membres du ménage de 6 sur 54 contacts 111%, mais cela peut s’expliquer par la méthodologie différente des études [11] Fait intéressant, dans notre étude, il y avait 6 mère-à- Figure 3 En ce qui concerne l’ESBL-Ec, les groupes phylogénétiques B2 8 de 28 contacts et D 9 de 34 contacts avaient tendance à être plus nombreux. souvent transmis au sein des ménages que les groupes A 3 de 19 contacts et B1 0 de 7 contacts, bien que cette différence n’atteigne pas la signification statistique P = 1 Néanmoins, le résultat est conforme aux groupes B2 et D étant plus transmissibles et virulents [21, 31 ]

Figure 3View largeDownload slideCaractéristiques des transmissions domestiques d’Escherichia coli et de Klebsiella pneumoniae productrices de β-lactamase à spectre étendu Les patients de l’indice, les contacts hospitaliers et les contacts familiaux sont indiqués Les grappes de ménages sont montrées dans des cases La présence du gène pabB est illustrée Pasteur K pneumoniae et Schéma de typage des séquences multilocus d’Achtman E coli Abréviations: Ec, Escherichia coli; SC, contact hospitalier; HHC, contact avec les ménages; Kp, Klebsiella pneumoniae; PFGE, électrophorèse sur gel à champ pulsé; rep-PCR, réaction en chaîne de polymérase palindromique extragénique; ST, type de séquence Figure 3Voir grandDownload slideCaractéristiques des transmissions domestiques d’Escherichia coli et de Klebsiella pneumoniae productrices de β-lactamase à spectre étendu, les contacts hospitaliers et les contacts familiaux sont indiqués Les grappes de ménages sont montrées dans des cases La présence du gène pabB est illustrée. déterminé selon le schéma de typage des séquences multilocus de Pasteur K pneumoniae et Achtman E coli Abréviations: Ec, Escherichia coli; SC, contact hospitalier; HHC, contact avec les ménages; Kp, Klebsiella pneumoniae; PFGE, électrophorèse sur gel à champ pulsé; rep-PCR, réaction en chaîne de polymérase palindromique extragénique; ST, type de séquence Comparable avec ESBL-Ec, le taux de transmission domestique de BLSE-Kp était de 25% 2 sur 8 contacts Comme les études précédentes se limitaient à la transmission BLSE-Kp dans les hôpitaux [32, 33], nous sommes incapables de comparer nos résultats. D’autres études, mais nous notons que les TS ESBL-Kp impliqués dans la transmission des ménages étaient de ST15 et ST147, qui ont été décrites ailleurs comme épidémie [34] Globalement, à la fois pour ESBL-Ec et BLSE-Kp le taux net de transmission était plus élevé le ménage que dans l’hôpital, bien que cette différence n’atteigne la signification statistique que pour BLSE-Ec P & lt; 001 L’une des explications de cette différence pourrait être liée aux temps d’exposition plus longs dans le ménage ambulatoire par rapport au milieu hospitalier

Dynamique de détection des producteurs de BLSE non liée à la transmission

Un nombre considérable de producteurs de BLSE détectés par le dépistage des patients hospitalisés ou des contacts familiaux n’a pas pu être expliqué par transmission à un patient index. Figure 1 En milieu hospitalier, cette proportion était légèrement supérieure à la prévalence des transmissions nosocomiales pour les deux BLSE. 57% vs 45% et BLSE-KP 167% vs 83% En particulier, la dynamique de détection des producteurs de BLSE chez les patients de contact était assez similaire pour les événements de transmission et de non-transmission Figure 4A Probablement, la détection des producteurs de BLSE nécessite un processus de sélection Ainsi, les tests standard, par exemple, les plaques d’agar sélectif effectuées à un moment donné, par exemple, à l’entrée de l’hôpital pourraient donc ne pas identifier tous les porteurs de BLSE. ESBL-Ec, 125% contre 227%; ESBL-Kp, 0% vs 25% Cependant, la dynamique de la détection des BLSE au cours du temps était encore assez similaire pour les deux groupes. Figure 4B

Figure 4View largeDownload slideIdentification des producteurs de BLSE de β-lactamases à spectre étendu par les courbes de Kaplan-Meier pour les contacts hospitaliers A et les contacts domestiques B “transmission BLSE” comprend les contacts qui ont été trouvés porteurs de la même souche BLSE que le patient index, et ” La BLSE sans transmission “décrit les contacts avec le transport ESBL mais sans correspondance avec la souche du patient indice selon la définition donnée dans les Méthodes Escherichia coli productrices de BLSE et Klebsiella pneumoniae sont regroupées Les différences entre les courbes ont été calculées en utilisant le test du log-rank Abréviations: Ec, Escherichia coli; BLSE, ß-lactamase à spectre étendu; Kp, Klebsiella pneumoniaeFigure 4View largeDownload slideIdentification des producteurs de BLSE de β-lactamase à spectre étendu par les courbes de Kaplan-Meier pour les contacts hospitaliers A et les contacts domestiques B “transmission BLSE” comprend les contacts qui portent la même souche BLSE que le patient index et “BLSE sans transmission” décrit des contacts avec le transport BLSE mais sans correspondance avec la souche de patients indice selon la définition donnée dans les Méthodes Escherichia coli productrices de BLSE et Klebsiella pneumoniae sont regroupées Les différences entre les courbes ont été calculées en utilisant le log -rank test Abréviations: Ec, Escherichia coli; BLSE, ß-lactamase à spectre étendu; Kp, Klebsiella pneumoniae

Limites de cette étude

Premièrement, les critères de transmission dans cette étude n’abordaient pas la possibilité de transmission horizontale de plasmides communs entre différentes espèces d’Enterobacteriaceae [35] Ainsi, les taux de transmission pourraient avoir été sous-estimés, mais ce biais hypothétique aurait dû affecter les ménages. Deuxièmement, notre étude ne permettait pas de déterminer si la transmission par les ménages a eu lieu chez les patients indexés ou par l’acquisition d’une source commune. En fait, plusieurs études ont suggéré que des sources communes telles que la nourriture peuvent contribuer à la transmission. Toutefois, pour 2 contacts familiaux, les contacts familiaux 118 et 158 ​​transmission interhumaine étaient probables, car dans les deux cas, les patients 110 et 70 concernés ont acquis le producteur de BLSE pendant leur hospitalisation et l’ont transmis. probablement ultérieurement à leurs contacts familiaux. La prévalence élevée de EBSL-Ec productrice de CTX-M-15 de ST131 indique également une transmission de personne à personne parce que les humains sont le principal réservoir de ce clone [6, 37] Globalement, selon nos données, nous spéculons que les patients récemment sortie d’un hôpital ou prise en charge en ambulatoire peut être une source de transmission plus efficace dans la communauté que les porteurs sains Que cette transmission puisse être contrôlée par des mesures préventives doit être évaluée

Conclusions

À notre connaissance, il s’agit de la première étude épidémiologique analysant simultanément les taux de transmission des producteurs de BLSE dans le ménage et le milieu hospitalier, soit dans la même période, dans la même zone géographique et avec le même indice. dépasse la transmission hospitalière dans un scénario non épidémique et que la transmission familiale est améliorée en présence de patients indexés récemment évacués ou soignés dans un hôpital. En outre, en dehors du foyer, l’importation de producteurs de BLSE dans les hôpitaux semble au moins fréquents comme événements de transmission pendant le séjour hospitalier Nos données suggèrent également que BLSE-Kp peut être transmise plus efficacement dans l’hôpital que BLSE-CE et questionner l’effet des mesures de contrôle de l’infection entre les différentes espèces D’autres études sont nécessaires pour traiter le dernier numéro

Remarques

Soutien financier Ce travail a été soutenu par des fonds internes de l’Institut des maladies infectieuses, Université de Berne, Berne, Suisse Conflits d’intérêts potentiels Tous les auteurs: Aucun conflit signaléTous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits potentiels Conflits d’intérêts que les éditeurs considèrent pertinents pour le contenu du manuscrit ont été divulgués