Détection des salmonelles typhoïdales et paratyphoïdiques dans le sang par réaction en chaîne de la polymérase en temps réel

Contexte L’étalon-or pour le diagnostic de la fièvre entérique causée par Salmonella Typhi ou Salmonella Paratyphi A ou B est la moelle osseuse. Cependant, comme l’aspiration de la moelle osseuse est hautement invasive, de nombreux hôpitaux et grands centres de santé effectuent des hémocultures. Méthodes Nous avons développé une méthode qPCR de réaction en chaîne de la polymérase en temps réel basée sur clyA pour détecter Salmonella Typhi et Salmonella Paratyphi A simultanément dans le sang. La sensibilité et la spécificité de cette sonde ont été testées. d’abord évalués in vitro en laboratoire, puis dans une population endémique typhoïde, à Karachi, au Pakistan, et chez des volontaires américains en bonne santé. Résultats Nous avons optimisé une méthode d’extraction d’ADN et de PCR en temps réel permettant de détecter de façon fiable Salmonella Typhi L’ensemble de sondes a été capable de détecter Salmonella Typhi et Salmonella Paratyphi A str. Sur le terrain, le diagnostic de clyA qPCR était aussi sensible que l’hémoculture. Cependant, lorsque les spécimens qPCR-positifs étaient considérés comme de vrais positifs, l’hémoculture ne présentait que des% d’hémocultures. La spécificité était de ≥% pour toutes les comparaisons et chez les volontaires américains sains qPCR était significativement plus rapide que l’hémoculture en termes de détection de la typhoïde et de la paratyphoïde. Conclusions Sur la base des leçons apprises, nous recommandons que de futurs tests sur le terrain détectent la typhoïde et la Salmonella non-typhoïde utilise plusieurs méthodologies pour définir un échantillon «positif»

r Les cas de Salmonella enterica sérovars Typhi et Paratyphi A se rencontrent en Asie du Sud et du Sud-Est, tandis que les infections invasives à Salmonella non nucléosidiques sont principalement observées en Afrique subsaharienne Le diagnostic clinique d’infection invasive à Salmonella est compliqué en raison de la similitude des symptômes. autres maladies fébriles telles que le paludisme, la dengue et les rickettsioses Les établissements de soins ambulatoires en milieu endémique manquent souvent de diagnostics en laboratoire, la plupart des diagnostics étant faits cliniquement et les antimicrobiens administrés empiriquement [, -] Une détection précoce et fiable est essentielle De plus, la capacité à impliquer de manière fiable la salmonelle comme cause de maladie permettrait d’améliorer les estimations de la charge à l’échelle nationale et mondiale, ce qui justifierait des investissements futurs dans le traitement et la prévention. méthodes et finalement permettant évaluation précise de ces interventions Les tests diagnostiques permettant de détecter les salmonelles invasives nécessitent des attributs différents en fonction du but. Un diagnostic pour les soins aux patients doit être rapide, sensible et spécifique; économique; simple à utiliser; et idéalement capable de détecter la résistance aux antibiotiques Un diagnostic qui serait utilisé pour mesurer la charge de morbidité devrait avoir les attributs suivants: sensible et spécifique; économique; et capable de différencier Salmonella Typhi, Salmonella Paratyphi A en Asie, Salmonella Typhimurium, Salmonella Enteritidis en Afrique et autres sérotypes de SalmonellaLes méthodes les plus largement disponibles de diagnostic en laboratoire de l’infection sanguine par Salmonella reposent sur la culture directe les bactéries viables soient présentes en quantités détectables au moment de l’échantillonnage des échantillons; cela s’est avéré être un obstacle majeur dans le diagnostic de Salmonella car les rapports de charge bactérienne sur les sites systémiques pendant l’infection invasive par Salmonella sont universellement bas et de nombreux patients ont reçu des antibiotiques avant leur arrivée à l’hôpital Fardeau bactérien varie au cours de l’infection, mais on rapporte qu’elle est similaire pour les salmonelles typhoïdales et non-typhoïdiques, qui établissent une niche intracellulaire à une densité de & lt; unité formant une colonie UFC / mL de sang périphérique ou UFC / mL de moelle osseuse La charge bactérienne est plus importante dans la moelle osseuse que dans le sang périphérique et augmente par rapport à celle du sang périphérique pendant l’antibiothérapie et la rechute L’hémoculture montre une sensibilité d’environ% -% pendant les premiers jours de l’infection. La sensibilité chute à% -% à des moments ultérieurs et bien que positivement corrélée avec le volume de prélèvement sanguin, le volume d’échantillon recommandé de mL peut être difficile à obtenir des enfants gravement malades La culture de la moelle osseuse est considérée comme la méthode la plus précise pour identifier une infection aiguë à Salmonella Typhi , mais nécessite des compétences techniques et un équipement approprié, est invasive et n’élimine pas la culture de laboratoire. identification sérologique subséquente La culture de la moelle osseuse n’a pas été entièrement évaluée en tant que diagnostic des infections invasives du NTS, tant chez les typhoïdes que chez les non-phytophages. Les méthodes de laboratoire les plus couramment utilisées pour l’hémoculture utilisent un instrument d’hémoculture automatisé suivi d’une identification bactériologique traditionnelle et de tests de sensibilité Les cibles diagnostiques des nouveaux tests de détection de la typhoïde comprennent les protéines bactériennes, les métabolites et En particulier, Zhou et Pollard ont montré que la préincubation du sang dans un milieu bactériologique peut améliorer la sensibilité des techniques moléculaires. Plusieurs groupes ont profité de l’utilisation de l’acide nucléique. Les autres méthodes utilisées pour diagnostiquer une infection aiguë à Salmonella Typhi impliquent la détection de marqueurs de réponse à l’hôte. Certains des tests les plus populaires sont les tests Widal, Tubex-TF, Typhidot IgG et Typhidot IgM, qui avoir bas à mod La TPTest, qui détecte les sécrétions d’anticorps de Salmonella Typhi et Salmonella Paratyphi A par des lymphocytes isolés La plupart des tests diagnostiques développés à ce jour ciblent la salmonellose typhoïde, mais avec des modifications ces tests pourraient être adaptés pour la détection d’iNTSNotre but était ici de développer une méthodologie PCR quantitative en temps réel basée sur la PCR quantitative pour détecter Salmonella Typhi et Salmonella Paratyphi A directement à partir du sang sans avoir besoin d’une étape de préincubation Nous visions à concevoir un test qui être plus sensible que l’hémoculture mais tout aussi spécifique, et significativement plus rapide en termes de temps de détection

MATÉRIAUX ET MÉTHODES

Souches bactériennes et sang

Salmonella Typhi Ty et Salmonella Paratyphi A ATCC ont été utilisées pour l’optimisation du test. Des souches cliniques envahissantes de Salmonella enterica ont été obtenues à partir de sang ou d’autres sites stériles de Mali Typhi et Typhi, Paratyphi A, Paratyphi B, Paratyphi C, Typhimurium, Enteritidis et Dublin. NTS ou Chili Typhi, Paratyphi A et Paratyphi B D’autres bactéries Streptococcus pneumoniae, Haemophilus influenzae, Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, sérotypes Salmonella enterica Choleraesuis et Newport provenaient des centres de contrôle et de prévention des maladies ou de la culture du Centre de développement des vaccins. des espèces de Salmonella, E coli, P aeruginosa, et K pneumoniae ont été cultivées dans du milieu bactériologique HS g de chlorure de sodium, g soytone [Teknova, Hollister, Californie], g Hy Yest [Sigma Aldrich, St Louis, Missouri] dans L eau distillée à ° C Streptococcus pneumoniae et H influenzae ont été repiqués sur des plaques disponibles dans le commerce BD BBL Tr Agar à l’héparine de soja avec% de sang de mouton / chocolat II, préparé à l’aide de plaques [Fisher Scientific, Pittsburgh, Pennsylvanie] à ° C Le sang humain entier avec anticoagulant à l’héparine de sodium a été acheté auprès de Biological Specialty Corporation Colmar, Pennsylvanie. avec l’approbation de l’Université du Maryland, Baltimore Institutional Review Board Tous les donneurs de sang ont fourni un consentement écrit éclairé

Extraction d’ADN

La fraction leucocytaire WBC a été isolée à partir de ≤ mL de sang total en utilisant le tampon de lyse érythrocytaire comme décrit précédemment Le surnageant a été décanté et des extractions d’ADN ont été effectuées en utilisant le kit QIAamp Blood DNA Mini Qiagen sur les pastilles WBC avec des modifications du protocole du fabricant. comme décrit dans les données supplémentaires ADN a été élué dans des pL d’eau sans nucléase

Pcr en temps réel

Les amorces et les sondes utilisées dans cette étude sont présentées dans le tableau Les sondes ont été conçues dans la version Primer express Applied Biosystems Les amorces ont été conçues en utilisant la version Primer PCR en temps réel a été réalisée en utilisant une réaction μL TaqMan Fast Universal PCR Master Mix Technologies, Grand Island, New York, μL sonde de mélange de sondes nM, amorce directe nM et amorce inverse nM, et matrice μL L’instrumentation utilisée était la machine de PCR en temps réel FAST Dx Life Technologies La dénaturation initiale était à ° C pendant quelques secondes. Des données ont été recueillies au cours de l’étape de recuit et d’extension. Un positif a été déterminé si l’amplification a recoupé le seuil dans les cycles. Les résultats signalés comme un seuil de cycle indéterminé Ct ont été examinés pour des indications de l’amplification tardive telle que décrite dans les contrôles de données supplémentaires ont été effectuées avec chaque réaction comme décrit dans le supplément Données ntary

Amorces de table et sondes utilisées dans cette étude Oligo séquence ‘to’ et Fluorophore Cibles de clonage de référence cible ST-Fc GGAGTCGCCGTTTTTAGACA Salmonella Typhi STY Ce travail ST-Rc TCCTTCAGCCAGCAGAGAAT Salmonella Typhi STY Ce travail PA-Fc AATTGGCGGCGTAGTGATAG Salmonella Paratyphi A SSPA Cette œuvre PA-Rc GTGAGGGGACAGATGTGGAG Salmonella Paratyphi A ASPS Ce travail clyA-F ATAGTCGCCGGTCCGTTTG Salmonella Typhi clyA Ce travail clyA-R GCCGCATCGATATCTTTATTCG Salmonella Typhi clyA Ce travail des amorces diagnostiques et des sondes ST-Probe FAM-CATTTGTTCTGGAGCAGGCTGACGG-TAMRA Salmonella Typhi STY ST-Frt CGCGAAGTCAGAGTCGACATAG Salmonella Typhi STY [ ] ST-Rrt AAGACCTCAACGCCGATCAC Salmonella Typhi STY Pa-Sonde CY-CCCATACAATTTCATTCTTATTGAGAATGCGC-BHQ Salmonella Paratyphi A SSPA Pa-Frt ACGATGATGACTGATTTATCGAAC Salmonella Paratyphi A SSPA Pa-Rrt TGAAAAGATATCTCTCAGAGCTGG Salmonella Paratyphi A SSPA phHV-Sonde CY-TTTTTATGTGTCCGCCACCATCTGGATC-BHQ Recombinant pCR TOPO gB PhHV-Frt GGGCGAATCACAGATTGAATC Recombinant pCR TOPO gB PhHV-Rr GCGGTTCCAAACGTACCAA Recombinant pCR TOPO gB clyA-Sonde FAM-CCGGTGCTGCAGCAGGCATA-TAMRA Salmonella Typhi et Salmonella Paratyphi A clyA Ce travail clyA- F TTATTTCCAGTCACAGGTGGATAG Salmonella Typhi et Salmonella Paratyphi A clyA Ce travail clyA-R CTAGTAAAGAAATTTTGCACTGCTTTTA Salmonella Typhi et Salmonella Paratyphi A clyA Ce travail clyA-Probe FAM-AACTGAATGAAGCGCAAAAATCTCTCCTGG-TAMRA Salmonella Typhi et Salmonella Paratyphi A clyA Ce travail clyA-F CAGCGCAGAAAGACATTCTCATC Salmonella Typhi et Salmonella Paratyphi A clyA Ce travail clyA-R GAAGCGTTGTTGAAACTTTGTGAA Salmonella Typhi et Salmonella Paratyphi A clyA Ce travail clyA-Probe FAM-ATTGCTGCGGGCGTGATTGAAGGGA-TAMRA Salmonella Typhi et Salmonella Paratyphi A clyA Ce travail Oligo Séquence ‘to’ et Fluorophore Cible Référence Clon ing amorces ST-Fc GGAGTCGCCGTTTTTAGACA Salmonella Typhi STY Ce travail ST-Rc TCCTTCAGCCAGCAGAGAAT Salmonella Typhi STY Ce travail Salmonella PA-Fc AATTGGCGGCGTAGTGATAG Paratyphi A ASPS Ce travail PA-Rc GTGAGGGGACAGATGTGGAG Salmonella Paratyphi A ASPS Ce travail clyA-F ATAGTCGCCGGTCCGTTTG Salmonella Typhi clyA Ce travail clyA -R GCCGCATCGATATCTTTATTCG Salmonella Typhi clyA Ce travail Sondes et sondes de diagnostic ST-Probe FAM-CATTTGTTCTGGAGCAGGCTGACGG-TAMRA Salmonella Typhi STY ST-Frt CGCGAAGTCAGAGTCGACATAG Salmonella Typhi STY ST-Rrt AAGACCTCAACGCCGATCAC Salmonella Typhi STY Pa-Sonde CY-CCCATACAATTTCATTCTTATTGAGAATGCGC- BHQ Salmonella Paratyphi A SSPA Pa-Frt ACGATGATGACTGATTTATCGAAC Salmonella Paratyphi A SSPA Pa-Rrt TGAAAAGATATCTCTCAGAGCTGG Salmonella Paratyphi A SSPA phHV-Sonde CY-TTTTTATGTGTCCGCCACCATCTGGATC-BHQ Recombinant pCR TOPO gB PhHV-Frt GGGCGAATCACAGATTGAATC Recomb inant pCR TOPO gB PhHV-Rrt GCGGTTCCAAACGTACCAA recombinant pCR TOPO gB clyA-Probe FAM-CCGGTGCTGCAGCAGGCATA-TAMRA Salmonella Typhi et Salmonella Paratyphi A clyA Ce travail clyA-F TTATTTCCAGTCACAGGTGGATAG Salmonella Typhi et Salmonella Paratyphi A clyA Ce travail clyA-R CTAGTAAAGAAATTTTGCACTGCTTTTA Salmonella typhi et Salmonella Paratyphi A clyA Ce travail clyA-Probe FAM-AACTGAATGAAGCGCAAAAATCTCTCCTGG-TAMRA Salmonella Typhi et Salmonella Paratyphi A clyA Ce travail clyA-F CAGCGCAGAAAGACATTCTCATC Salmonella Typhi et Salmonella Paratyphi A clyA Ce travail clyA-R GAAGCGTTGTTGAAACTTTGTGAA Salmonella Typhi et Salmonella Paratyphi A clyA Ce travail clyA-Probe FAM-ATTGCTGCGGGCGTGATTGAAGGGA-TAMRA Salmonella Typhi et Salmonella Paratyphi A clyA Ce travail Agrandir l’image

Évaluation in vitro de la spécificité

La spécificité des amorces a été testée sur des lysats bouillis clarifiés de Salmonella enterica sérotypes Typhi, Paratyphi A, Paratyphi B, Paratyphi C, Typhimurium, Enteritidis, Dublin, Choleraesuis et Newport et d’autres bactéries, y compris S pneumoniae, K pneumoniae, H influenzae, P aeruginosa, et E coli Le tableau 3 aux colonies a été suspendu dans de l’eau de qualité moléculaire et porté à ébullition à ° C pendant quelques minutes dans un cycleur thermique. Le lysat a été centrifugé à vitesse maximale dans une microcentrifugeuse pendant une minute. la dilution du lysat clarifié a été testée dans une réaction de -μL pour l’amplification de l’amplicon clyA

Spécificité de la table des espèces de ClyA Probeset Serovar, Pathotype, ou Souche Nom Source de Souches Testées Positives ou Négatives par qPCR Escherichia coli BORT CVD – E coli EPEC E / CVD E coli EAEC O CVD Streptococcus pneumoniae Sérotypes b,, f, CVD – Haemophilus influenzae Souches et CVD-Mali – Klebsiella pneumoniae B CVD – Pseudomonas aeruginosa PAO CVD – Salmonella enterica Paratyphi B MNZ CVD-Chili – S enterica Paratyphi CP CVD-Mali – S enterica Typhimurium SL CVD, I CVD-Mali – S enterica Enteritidis R CVD-Mali – S enterica Dublin P, R CVD-Mali – S enterica Choleraesuis – CDC – S enterica Newport – CDC – S enterica Variétés cliniques de Salmonella Typhi CVD-Mali et CVD-Chile S enterica Plusieurs souches de Salmonella Paratyphi A CVD- Mali et espèces CVD-Chili Sérovar, pathotype ou nom de la souche Source Nombre de souches testées Positif ou négatif par qPCR Escherichia coli BORT CVD – E coli EPEC E / CVD E coli EAEC O CVD Streptococcus pneumoniae Sérotypes b,, f, CVD – Haemophilus influenzae Souches et CVD-Mali – Klebsiella pneumoniae B CVD – Pseudomonas aeruginosa PAO CVD – Salmonella enterica Paratyphi B MNZ CVD -Chili – S enterica Paratyphi CP CVD-Mali – S enterica Typhimurium SL CVD, I CVD-Mali – S enterica Enteritidis R CVD-Mali – S enterica Dublin P, R CVD-Mali – S enterica Choleraesuis – CDC – S enterica Newport – CDC – S enterica Plusieurs souches cliniques de Salmonella Typhi CVD-Mali et CVD-Chili S entica Multiple Salmonella Paratyphi A souches cliniques CVD-Mali et CVD-Chile Abréviations: CDC, Centers for Disease Control and Prevention; CVD, collection de culture CVD; CVD-Chile, isolé au Chili; CVD-Mali, isolé au Mali; CEEA, Escherichia coli entéroagrégatif; EPEC, Escherichia coli entéropathogène; qPCR, réaction en chaîne par polymérase en temps réelView Large

Évaluation in vitro de la sensibilité

La souche de référence Salmonella Typhi Ty a été cultivée pendant une nuit dans des milieux HS à environ × CFU / mL. Serial: des dilutions de bactéries ont été faites dans une solution saline tamponnée au phosphate Un total de μL de suspension bactérienne a été ajouté au culot de WBC généré après la lyse des érythrocytes. l’ADN génomique a été extrait comme décrit ci-dessus. L’UFC réelle utilisée pour élever les pastilles WBC a été déterminée en réalisant des numérations viables en utilisant les dilutions attendues – CFU / mL

Sites d’étude

L’évaluation du diagnostic basé sur la qPCR de Salmonella a été réalisée à Karachi, au Pakistan Les sites d’étude pour l’inclusion des cas de typhoïde comprenaient le service d’urgence de l’hôpital AKU de l’Université Aga Khan; le laboratoire principal de l’hôpital AKU; et le point de collecte des échantillons au laboratoire satellite Garden AKU Les contrôles ont été inscrits dans les centres de soins primaires gérés par le Département de pédiatrie de l’AKU, situés dans les zones à faible revenu de Karachi Rehri Goth, Bhains Colony

Participants

Les participants ayant les critères d’inclusion suivants ont participé à l’étude: – fièvre vénérienne, fiévreuse ou fièvre paratyphoïde cliniquement soupçonnée, avec fièvre documentée ≥ ° C et aucun autre foyer identifié d’infection au moment de la présentation, qui a donné son consentement et son consentement pour obtenir sang pour la culture et qPCR Les participants répondant à l’un des critères suivants ont été exclus de la participation à l’étude: fièvre avec des signes cliniques indiquant un foyer clair d’infection rendant improbable un diagnostic de fièvre entérique; cas diagnostiqués de malignités hématologiques présentant une neutropénie fébrile; ou refus de consentement ou d’assentiment Les participants au contrôle qui répondaient aux critères d’inclusion suivants ont participé à l’étude: enfants âgés de – ans sans signes d’infection active, qui ont donné leur consentement et ont donné leur consentement pour obtenir du sang pour culture et qPCR

Méthodes de laboratoire d’étude clinique

Des volumes égaux de sang ont été testés par culture hématologique et PCR en temps réel à l’aveugle. Pour les enfants âgés de 1 à 5 ans, jusqu’à 100 ml de sang ont été testés par hémoculture et un volume équivalent testé par qPCR. a été testée par culture du sang et un volume équivalent par qPCR culture de sang a été effectuée en utilisant une machine Bactec et des techniques microbiologiques standard a été effectuée en temps réel par PCR en lysant les érythrocytes, isolement de l’ADN en utilisant un QIAamp DNA Blood Mini Kit de Qiagen et ensuite la détection de Salmonella typhi et Salmonella Paratyphi A en ciblant le gène clyA comme décrit ci-dessus

Analyses statistiques

Prisme a été utilisé pour la plupart des analyses statistiques et la représentation graphique Les données ont été analysées en utilisant Mann-Whitney test -toute ou l’analyse de la variance -way ANOVA Les résultats ont été considérés comme significatifs si P & lt; La sensibilité et la spécificité avec les intervalles de confiance en% ont été calculées en utilisant les tables × sur le site Web de MedCalcnet https: // wwwmedcalcnet / tests / diagnostic_testphp

Éthique de la recherche

Cette étude a été approuvée par le comité d’éthique de recherche AKU et le comité d’examen institutionnel de l’école de médecine de l’Université du Maryland

RÉSULTATS

Développement d’un test qPCR hautement sensible

Nous avons conçu plusieurs amorces et sondes pour détecter simultanément Salmonella Typhi et Salmonella Paratyphi A Nous avons ciblé clyA aussi connu comme hlyE, qui est conservé dans Salmonella Typhi et Salmonella Paratyphi A mais absent des autres sérovars Salmonella Certains E coli hébergent aussi clyA Nous avons donc tenté de concevoir des sondes spécifiques pour Salmonella Typhi et Salmonella Paratyphi A clyA, mais elles n’étaient pas aussi efficaces que d’autres sondes qui ont également lié des données E coli non montrées. Nous avons évalué l’efficacité de plusieurs amorces et sondes clyA et déterminé que clyA-sonde, et les amorces clyA-F et clyA-R ont été aussi efficaces que les sondes Salmonella Typhi et Salmonella Paratyphi A décrites précédemment Tableau supplémentaire Ce test a été utilisé pour toutes les analyses suivantesNext, nous avons optimisé la préparation du modèle d’ADN pour améliorer la sensibilité. montré précédemment qu’en ciblant les lymphocytes soit en lysant les érythrocytes, soit en isolant la couche leucocytaire, nous sommes en mesure de Nous avons montré que la limite de détection de qPCR était diminuée lorsque la lyse érythrocytaire était réalisée avant l’extraction de l’ADN à l’aide du kit QIAamp Blood DNA Mini Qiagen comparé à quand l’ADN était directement dans le kit QIAamp Blood DNA Midi Qiagen Dans la présente étude, nous avons amélioré notre limite de détection en modifiant la procédure d’extraction d’ADN comme décrit dans les données supplémentaires Un diagramme schématique de l’extraction d’ADN et de la procédure qPCR est présenté. Les autres méthodes basées sur la PCR n’utilisent qu’une fraction de la matrice d’ADN disponible pour l’amplification Ici, nous avons élué l’ADN dans de l’eau sans nucléase et testé la majorité de l’échantillon par des réactions qPCR contenant μL de matrice chacun Nous avons émis l’hypothèse que s’il y avait une bactérie présente dans le sang mL, ce qui est susceptible de se produire en fonction des résultats de prev Des études scientifiques , lorsque cet échantillon est testé par qPCR, la cible du gène clyA pourrait être pipettée dans un seul puits. En conséquence, nous avons interprété un échantillon comme positif pour qPCR si au moins le puits était positif Pour maximiser les chances de détecter un résultat positif, nous avons utilisé un seuil de Ct au lieu de ce qui est généralement utilisé pour d’autres tests. Nous avons examiné les données brutes qPCR de près pour nous assurer que les puits interprétés comme positifs présentaient une amplification réelle telle que décrite dans les données supplémentaires.

Sensibilité in vitro et spécificité à l’aide de sang enrichi

Nous avons évalué la méthode d’extraction de l’ADN optimisée et la PCR quantitative en laboratoire et déterminé la sensibilité et la spécificité in vitro. Nous avons isolé des lymphocytes de – mL de sang, puis ajouté diverses concentrations de Salmonella Typhi, ADN isolé, et effectué qPCR en utilisant la sonde clyA. , des utilisateurs distincts ont pu détecter approximativement CFU / mL de sang et même détecter aussi peu que CFU / mL détectant très probablement des bactéries mortes Comme prévu, nous avons observé une courbe dose-réponse par laquelle des concentrations plus élevées de Salmonella Typhi ont abaissé les Ct. courbe de réponse pour des concentrations plus élevées de bactéries & gt; UFC / mL mais pas pour des concentrations plus faibles & lt; CFU / mL Nous croyons qu’aux concentrations & lt; CFU / mL, des effets d’échantillonnage se produisent et on observe la détection obtenir une valeur Ct ou aucune détection exprimée par la machine comme indéterminée mais que nous avons exprimée comme un Ct de la figure Même dans des conditions avec une efficacité de réaction quasi-parfaite , cohérente les répliques pour Ct sont obtenues lorsqu’il y a & gt; copies de target , mais la variation de Ct est plus grande pour les cibles à faible nombre de copies Spiking of blood with & lt; Salmonella Typhi CFU / mL n’a pas entraîné d’amplification

Figure Vue largeDownload slideIn sensibilité in vitro de la réaction en chaîne par polymérase en temps réel de Salmonella qPCR test Des lymphocytes ont été isolés à partir de mL de sang humain entier en lysant les globules rouges Les granulés cellulaires ont été enrichis de diverses concentrations de Salmonella Typhi Ty et l’ADN a été isolé en utilisant un QIAamp Blood DNA Mini kit et testé à l’aide du clyA qPCR Les symboles colorés représentent différents utilisateurs et les différents symboles représentent des expériences réalisées à différentes occasions Les données sont exprimées en moyenne ± déviation standard des puits de réplique Le seuil maximal du cycle Ct est cycles Wells avec un Ct indéterminé Les lymphocytes ont été isolés à partir de – mL de sang humain entier en lysant les globules rouges. Les granules cellulaires ont été enrichis avec différentes concentrations de Salmonella Typhi Ty et de l’ADN. a été isolé à l’aide d’un kit QIAamp Blood DNA Mini et testé chanter le clyA qPCR Les symboles colorés représentent différents utilisateurs et les différents symboles représentent des expériences effectuées à différentes occasions Les données sont exprimées en moyenne ± écart-type des puits de réplique Le seuil de cycle maximal Ct est cycles Les puits avec Ct indéterminé ont été assignés un Ct de We Comme prévu, E coli entéro-agrégat et E coli entéropathogène ont été détectés. Tableau Cependant, E coli Bort, qui est une souche E coli invasive, était négatif par qPCR Nous avons confirmé Tous les autres sérovars de Salmonella Typhimurium, Enteritidis, Dublin, Paratyphi B, Paratyphi C, Choleraesuis, Newport et les souches non-Salmonella K pneumoniae, S pneumoniae, H influenzae, P aeruginosa testés et détectés par Salmonella Typhi et Salmonella Paratyphi A. négatif par qPCR

Évaluation de la spécificité du diagnostic qPCR en utilisant des donneurs sains des États-Unis

Nous avons déterminé la spécificité de notre clyA test de diagnostic basé sur qPCR en testant le sang de santé donneurs américains sang humain total a été lysées en utilisant un tampon de lyse érythrocytaire et l’ADN a été extrait de lymphocytes et testés par qPCR quatre spécimens% ont été testés positifs par qPCR Tableau Pour chacun de ces échantillons , seulement bien testé positif et produit des valeurs élevées de Ct de,,, et Par conséquent, en utilisant du sang de donneurs américains en bonne santé, la spécificité du test qPCR est de%

Spécificité de la table de la clyA Probeset Utilisation de sang provenant de donneurs US sains Positif ou négatif par qPCR Nombre de volontaires Négatif% Positif% Total Positif ou Négatif par qPCR Nombre de volontaires Négatif% Positif% Abréviation totale: qPCR, réaction en chaîne par polymérase en temps réel

Évaluation du diagnostic qPCR dans une région typhoïde endémique

Nous avons évalué notre diagnostic basé sur qPCR dans une population pédiatrique à Karachi, Pakistan Nous avons recruté des enfants – ans qui ont eu la fièvre ≥ ° C pendant au moins jours et contrôles sains Un volume égal de sang a été testé par hémoculture et qPCR Vingt enfants testés Salmonella Typhi ou Salmonella Paratyphi A en utilisant des méthodes microbiologiques standard Tableau Parmi ceux-ci, possédaient Salmonella Typhi et possédaient Salmonella Paratyphi A Enfants supplémentaires testés positifs pour les cas d’espèces Bacillus, cas d’espèce Micrococcus et cas d’espèce Staphylococcus Parmi les cas hémocultés positifs Nous avons confirmé que la sonde clyA était capable de se lier à l’ADN de toutes les souches de Salmonella Typhi et de Salmonella Paratyphi A identifiées par l’hémoculture. Par conséquent, l’absence de détection n’était pas due à Salmonella Typhi ou Salmonella Paratyphi A à l’absence de liaison des amorces ou de la sonde

Catégorie qPCR Positif qPCR Négatif Total Cliniquement diagnostiqué avec des cas de fièvre entérique hémoculture positif pour Salmonella Typhi ou Salmonella Paratyphi A Culture sanguine négative aucune bactérie détectée Contrôle sain Sang culture positive pour Salmonella Typhi ou Salmonella Paratyphi A Culture sanguine négative Aucune bactérie détectée Catégorie qPCR Positif qPCR Négatif Total Cliniquement diagnostiqué avec des cas de fièvre entérique hémoculture positive pour Salmonella Typhi ou Salmonella Paratyphi A hémoculture négative aucune bactérie détectée contrôles sains hémocultures positives pour Salmonella Typhi ou Salmonella Paratyphi A Culture sanguine négative aucune bactérie détectée Abréviation: qPCR, réaction en chaîne de la polymérase en temps réelView Large

Bactéries détectées à partir de cultures de sang positives de cas à Karachi, Pakistan Bactéries Nombre de souches confirmées se lier à clyA Probeset Salmonella Typhi Salmonella Paratyphi A Bacillus spp ND Micrococcus spp ND Staphylococcus spp ND Bactéries Aucune des souches confirmées se lier à clyA Probeset Salmonella Typhi Salmonella Paratyphi A Bacillus spp ND Micrococcus spp ND Staphylocoque spp ND Abréviation: ND, non déterminé View LargeNous avons déterminé la sensibilité et la spécificité de la clyA qPCR et de l’hémoculture en utilisant l’autre comme comparateur Tableau Le diagnostic clyA qPCR était% aussi sensible que l’hémoculture Lorsque qPCR- les échantillons positifs ont été considérés comme de vrais positifs, l’hémoculture n’a montré que% de sensibilité La spécificité était ≥%

Comparaison entre les tests de culture sanguine et de réaction en chaîne de la polymérase en temps réel Comparaison entre les cas et les contrôles de Karachi, Pakistan Test Assay Comparateur Vrai Sensibilité Positive% CI Spécificité% CI qPCR Culture sanguine%% -%%% -% Sang culture qPCR%% -%%% -% Test Test Comparateur Vrai Positif Sensibilité% CI Spécificité% CI qPCR Culture sanguine%% -%%% -% hémoculture qPCR%% -%%% -% Abréviations: IC, intervalle de confiance; qPCR, réaction en chaîne par polymérase en temps réel View LargeNous avons examiné les spécimens positifs pour qPCR afin de déterminer s’il y avait des différences entre les échantillons positifs pour la culture sanguine et négatifs pour la culture sanguine. les échantillons signifient ± écart type [SD], ± Ct contre ± Ct mais la différence n’est pas significative P =, test de Mann-Whitney; Figure Nous avons également examiné l’âge de tous les cas d’enfants et les contrôles qui étaient soit positifs hémocultures ou qPCR positif ou les deux Figure A Il n’y avait pas de différences significatives dans l’âge ANOVA by-way Nous avons également examiné les volumes sanguins testés par hémoculture et qPCR pour tous les échantillons positifs pour la culture sanguine ou qPCR-positifs Figure B Il n’y avait pas de différences significatives dans les volumes testés par culture sanguine par rapport à la culture sanguine qPCR négative / qPCR positive: moyenne ± SD, ± mL et ± mL, respectivement; hémoculture positive / qPCR négatif: ± mL et ± mL, respectivement; hémocultures positives / qPCR positives: ± et ± mL, respectivement; Test de Mann-Whitney Cependant, les échantillons négatifs pour la culture du sang et qPCR-positifs étaient presque significativement différents.

Vue de la figure grandDownload slideCycle threshold Valeurs Ct des échantillons en temps réel de réaction en chaîne de la polymérase en fonction du résultat de la culture sanguine Les données sont exprimées sous forme de boîte et de moustaches avec des moustaches représentant les valeurs minimales et maximalesFigure Les résultats sont exprimés sous la forme d’un graphique à boîte et à moustaches avec des trichites représentant la valeur minimale et la valeur maximale.

Figure vue grandDownload slideAge A et volume de sang testé B de spécimens qui étaient hémocultures négatives et réaction en chaîne par polymérase en temps réel qPCR positif; hémoculture positive et qPCR négatif; et positifs pour l’hémoculture et qPCR Les données d’âge sont exprimées sous forme de boîte et moustaches avec des moustaches représentant la valeur minimale et maximale. Les volumes sanguins sont exprimés sous forme de nuage de points avec la barre indiquant la moyenne Abréviations: -ve, négatif; ve, positif; Cx, cultureFigure View largeTélécharger la diapositive A et le volume de sang testé B des échantillons qui étaient hémocultures négatives et la réaction en chaîne par polymérase en temps réel qPCR positif; hémoculture positive et qPCR négatif; et positifs pour l’hémoculture et qPCR Les données d’âge sont exprimées sous forme de boîte et moustaches avec des moustaches représentant la valeur minimale et maximale. Les volumes sanguins sont exprimés sous forme de nuage de points avec la barre indiquant la moyenne Abréviations: -ve, négatif; ve, positif; Nous avons mesuré le temps de traitement des échantillons sanguins par la lyse érythrocytaire qPCR et l’extraction de l’ADN et qPCR par rapport à la détection de la culture de sang par instrumentation. identification par la microbiologie clinique classique Comme représenté sur la figure, qPCR est significativement plus rapide ± SD, heures minutes ± minutes que la moyenne hémisphérique ± SD, heures minutes ± heures en termes de détection et d’identification de Salmonella Typhi et Salmonella Paratyphi AP & lt; ; Test de Mann-Whitney, terminé

Figure View largeTélécharger slideTime d’identification pour l’hémoculture ou réaction en chaîne par polymérase en temps réel qPCR positivité Les données sont exprimées sous forme de boîte et moustaches avec des moustaches représentant la valeur minimale et maximale. Les données ont été analysées à l’aide du test Mann-Whitney. slideTime à l’identification pour la culture de sang ou la réaction en chaîne par polymérase en temps réel qPCR positivité Les données sont exprimées sous forme de boîte-moustache avec des moustaches représentant la valeur minimum et maximum. Les données ont été analysées en utilisant le test de Mann-Whitney.

DISCUSSION

La concentration médiane de Salmonella Typhi dans le sang est de – CFU / mL, ce qui signifie qu’il y avait – CFU par échantillon Par conséquent, il est concevable que pour l’hémoculture positive / Des échantillons qPCR-négatifs, CFU ont été détectés par hémoculture, mais en raison de l’échantillonnage, il n’y avait pas de bactéries disponibles pour la détection par qPCROur données suggèrent que les spécimens hémocultures négatives mais qPCR-positives ont une concentration bactérienne inférieure à la culture hémocultulaire Cependant, les différences dans les valeurs de Ct n’étaient pas statistiquement significatives. Sur la base de nos résultats, nous recommandons que les futurs essais de terrain emploient des méthodologies de diagnostic multiples pour définir un «positif» Échantillon Nous suggérons que les futurs tests de diagnostic typhoïde / paratyphoïde doivent d’abord être testés dans une population adulte où des volumes sanguins plus importants peuvent être obtenus et testés simultanément. Si possible, le nouveau diagnostic doit être comparé à la culture de la moelle osseuse, car cette méthode a montré la plus grande sensibilité à ce jour Si la culture de la moelle osseuse n’est pas faisable, la culture de sang doit être réalisée avec au moins d’autres tests de diagnostic, par exemple, qPCR avec ou sans pré-enrichissement vs un immunodosage tel que le TPTest Si au moins les tests sont positifs, alors l’échantillon doit être considéré comme un vrai positif. Pour le diagnostic iNTS, une approche similaire pourrait être utilisée pour les diagnostics de la typhoïde, mais avec de légères différences dues aux populations susceptibles d’être infectées par l’INNT. Les tests iNTS pourraient d’abord être testés. chez les adultes infectés par le virus de l’immunodéficience humaine, puis évalués chez les nourrissons. En plus des mesures quantitatives standard de performance, les caractéristiques opérationnelles des futurs tests typhoïde et iNTS doivent également être prises en compte. Elles incluent des facteurs tels que le délai de diagnostic définitif, la simplicité technique, le coût et la stabilité des réactifs et des équipements, et le niveau de formation du personnel nécessaire pour effectuer un test de manière fiable et interpréter les résultats. La PCR présente de nombreux avantages par rapport aux autres technologies, notamment la capacité de détecter différentes cibles bactériennes sur la même plate-forme / équipement; permettre la spéciation, la détection des gènes de résistance aux antibiotiques et l’évolution de la sélection des cibles à mesure que les connaissances sur les souches de la flambée en circulation évoluent; et manque de nécessité pour la viabilité bactérienne Cependant, la PCR présente plusieurs inconvénients, notamment le fait que le degré élevé de spécificité peut limiter l’utilité d’ensembles d’amorces spécifiques à des espèces cibles validées et nécessite des tests de détection, de sensibilité et de spécificité sur de nombreux sérovars [ ] les cibles doivent être sélectionnées et présentes dans toutes les espèces et tous les sérovars pertinents; un laboratoire centralisé avec un personnel qualifié est requis ; La force de cette étude réside dans le fait que la totalité du dosage, y compris l’extraction des acides nucléiques, la qPCR et l’analyse, a été effectuée sur site dans un laboratoire hospitalier approprié par des techniciens de l’utilisateur final. en laboratoire, les caractéristiques de performance doivent ensuite être évaluées sur le terrain pour lequel le test est prévu Les écarts de performance entre les laboratoires de développement et les essais sur le terrain sont particulièrement importants pour les dosages avec une sensibilité accrue ou une complexité technique tests de détection des acides nucléiques, car de nombreux facteurs, y compris les conditions de transport des réactifs et la variabilité de l’opérateur ou de l’opérateur, peuvent altérer considérablement les performances.Les deux attributs souhaitables d’un diagnostic typhoïde sont une sensibilité améliorée par rapport à l’hémoculture.La PCR est significativement plus rapide pour détecter et identifier Salmonella Typhi ou Salmonella Paratyphi A que les techniques microbiologiques classiques. Nous nous attendons également à ce que la détection de l’iNTS soit améliorée. Le développement de diagnostics typhoïdiens et paratyphoïdiques nouveaux et améliorés a été difficile, mais avec d’autres tests et évaluations. Les premiers tests diagnostiques sur Salmonella devraient cibler Salmonella Typhi et Salmonella Paratyphi A en préparation des programmes d’évaluation des vaccins contre la typhoïde et la paratyphoïde imminents Cependant, des tests diagnostiques supplémentaires devraient également cibler les SNiTs. telles que Salmonella Typhimurium et Salmonella Enteritidis, qui sont une cause importante de morbidité et de mortalité en Afrique subsaharienne et pour lesquelles des vaccins sont également en cours de développement

Remarques

Remerciements Nous remercions le Dr Stephen Baker pour le don généreux du plasmide PhHV-gB. Nous remercions également le Dr Sandra Panchalingam pour ses suggestions sur la réaction en chaîne de la polymérase en temps réel, l’analyse qPCR et son soutien financier. Melinda Gates Fondation subvention numéro OPP à M M LSupplement parrainage Cet article est apparu dans le cadre du supplément “Invasive Salmonella Disease en Afrique”, parrainé par l’Université de OtagoPotentiel conflits d’intérêts Au cours de ce travail, A K Z a rejoint le Bill & amp; Melinda Gates Foundation Pour éviter les conflits d’intérêts potentiels, FQ a remplacé AKZ en tant que chercheur principal AKU Tous les autres auteurs ne signalent aucun conflit potentiel Tous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits potentiels Conflits d’intérêts jugés pertinents par le contenu du manuscrit ont été divulgués